New penicillin acylase activity for aculeacin A acylase from Actinoplanes utahensis

Aculeacin A acylase from Actinoplanes utahensis produced by Streptomyces lividans 1 revealed new acylase activities being able to hydrolyse penicillin V and several natural 2 aliphatic penicillins. Penicillin K was the best substrate showing a catalytic efficiency of 3 34.79 mM-1 s-1. Furthermore, aculeacin A acylase was highly thermostable with a midpoint 4 transition temperature (Tm) of 81.5ºC. 5 1 catalyses the hydrolysis of the acyl moiety of antifungal echinocandin antibiotics produced by 2 Aspergillus species (13) (Fig. 1A). These cyclic hexapeptide antibiotics contain a long fatty 3 acid side chain (e. g., linoleic, myristic or palmitic acid) and exhibit a high antifungal activity. 4 They have been used to produce several potential therapeutic agents after enzymatic 5 hydrolysis of their acidic moieties that releases a cyclic hexapeptide which can be further 6 reacylated (3, 6). 7 AuAAC is largely extracellular and consists of two dissimilar subunits of 60 kDa and 19 8 kDa (8, 18). Remarkably, although this acylase shares sequence similarity with β-lactam 9 acylases (8, 11), it has not been reported to show a penicillin acylase activity. Preliminary 10 analyses carried out in our laboratory showed that AuAAC was very similar to the β-lactam 11 acylase from Streptomyces lavendulae (AY611030) that shows a preference for penicillins 12 with long hydrophobic acyl moieties (21). On the other hand, although AuAAC has been 13 purified (8, 9, 18) only few data on its structure-function relationships have been provided so 14 far and many biochemical properties of these proteins remain to be analyzed. 15 Taking into account these observations we have investigated if AuAAC would behave as a 16 new β-lactam acylase with novel properties. In this work we describe new hydrolytic 17 activities for AuAAC overproduced and purified from a recombinant Streptomyces lividans 18 harbouring the aac gene. 19 Overproduction of AuAAC. To overproduce AuAAC an engineered aac gene was 20 constructed and cloned into the bifunctional expression vector pEM4 which contains the 21 ermE* promoter from Saccharopolyspora erythraea (15). The aac gene, including its signal 22 peptide encoding sequence, was amplified by PCR using chromosomal DNA from A. 23 utahensis NRRL 12052 as template (8, 18). The PCR primers were designed according to the 24 DNA sequence of aac (8). The primers used were AAC53 25 A C C E P T E D 4 (5´TGCTCTAGAGGAGGTGCCGCCGTGACGTCCTCGTACATGCGCC3) and AAC31 1 (5´CCGGAATTCCTCAGCGTCCCCGCTGTGCCAC3). The restriction sites XbaI and EcoRI 2 are …